Forget the humble double helix: scientists from Cambridge University have now spotted four-stranded strings of DNA working inside human cells.
The researchers have published a paper in Nature Chemistry that demonstrates the existence and function of quadruple helix human DNA. The researchers believe it might be related to cancer — and that understanding it could be key to treating the disease in the future. Prof Shankar Balasubramanian from Cambridge University explains to the BBC:
“The existence of these structures may be loaded when the cell has a certain genotype or a certain dysfunctional state. We need to prove that; but if that is the case, targeting them with synthetic molecules could be an interesting way of selectively targeting those cells that have this dysfunction.”
The four-stranded DNA is known as the G-quadruplex. That “G” refers to guanine, which is one of the four chemical bases which form DNA, and it seems the quadruple helix tends to form wherever there are unusually high concentrations of the base. The team were able to spot the G-quadruplex in human cells by creating proteins that bind to its structure — made possible by the fact that it’s been spotted before in microscopic organisms called ciliates. The scientists watched as the quadruplex became more prevalent during cell division.
Now the researchers know that the four-stranded DNA is present in humans, they’re set to explore its implications for cancer treatment. “I’m hoping now that the pharmaceutical companies will bring this on to their radar and we can perhaps take a more serious look at whether quadruplexes are indeed therapeutically viable targets,” Balasubramaninan told the BBC. Here’s hoping he’s onto something. [Nature Chemistry via BBC]























So gaunine makes up the entire structure of the quad-helix? That's really really cool. I wonder if the structure replicates in the same way through a single peptide strand as double helix does. Very cool
"guanine, which is one of the four chemical bases which form DNA"
I have no idea about this science shit, but just in case you read wrong
Guanine is just one paired structure of the DNA sequencing. G (Guanine) is always paired opposite to C, while T is always paired with A, so if it were a line, it would look like this.
TATGGCGTAGTACTGACTATAATT
ATACCGCATCATGACTGATATTAA
But if the quad helix is just made up of guanine would make it hard for the structure to hold, wel it might. It would just look like this
GGGGGGGGGG
GGGGGGGGGG
GGGGGGGGGG
GGGGGGGGGG
The entire strand of it would be very jenky as a protein structure.
I have no idea about anything you just said hahaha, sometimes I feel like I'm too stupid for this website.